Skip to content

Potrójna infekcja HIV-1

4 tygodnie ago

805 words

Podwójna infekcja różnymi szczepami wirusa HIV typu (HIV-1) jest zgłaszana ze zwiększoną częstotliwością, przypisywana głównie koinfekcji w czasie pierwotnej infekcji. Jednak niektórzy pacjenci byli nadinfekowani drugim wirusem po pierwotnej serokonwersji 1, co ogólnie przyspieszyło progresję choroby.2
Rysunek 1. Ryc. 1. Zmiany poziomu RNA HIV-1 w osoczu, liczby komórek CD4 + i sekwencje wirusowe w próbkach pobranych od holenderskiego pacjenta, który był w znacznym stopniu zainfekowany trzema szczepami wirusa HIV-1. Sekwencje V3 wirusa HIV-1 (env) zamplifikowano z osocza z poprzedzającym primerem 5 ACAGGGCCATGYAMAAATGT3 i dalszym starterem 5 CCCCTCCACAATTAAARCTRTG3 , który może amplifikować oba podtypy B HIV-1 i CRF01_AE. Przeprowadzono analizę reakcji łańcuchowej polimerazy z odwrotną transkryptazą, jak opisano gdzie indziej.3 Fragmenty sklonowano i zsekwencjonowano3; liczba otrzymanych klonów jest wskazana dla każdego podtypu wirusa (B1 jest pokazany jako żółty, B2 zielony i AE pomarańczowy). Dodatkowe amplifikacje za pomocą starterów swoistych dla szczepu potwierdziły brak podtypu B2 i CRF01_AE we wczesnych punktach czasowych (dane nie pokazane).
Ryc. 2. Ryc. 2. Drzewa filogenetyczne env i gag Fragmenty uzyskane od tego samego Pacjenta. W panelu A drzewo filogenetyczne pokazuje różne fragmenty env uzyskane od pacjenta w momencie drugiej superinfekcji. Sekwencje odniesienia pobrano z bazy danych sekwencji HIV w Laboratorium Narodowym Los Alamos (http://hiv-web.lanl.gov). Drzewo opiera się na macierzy odległości obliczonej za pomocą metody 2-parametrycznej Kimura i skonstruowanej z opcją NJ dostępną w pakiecie oprogramowania Mega (www.megasoftware.net). Przeanalizowano pięćset powtórzeń programu startowego. Kolory są takie same jak na rysunku 1. W panelu B drzewo filogenetyczne pokazuje różne fragmenty klatek otrzymanych od pacjenta w momencie drugiej nadkażenia. Fragmenty gag amplifikowano z osocza jak opisano gdzie indziej, 3 ze starterami LOUW-1-gag 5 TTGACTAGCGGAGGCTAGAA3 i SK39 5 TTGGTCCTTGTCTTATGTCCAGAATGC3 i zagnieżdżonym zestawem starterów GAG-2I 5 GGGAAAAAATTCGGTTAIGGCC3 i GAGAE-3 5 ACTATTTTATTTAATCCCAGGAT3 .
Napotkaliśmy na przypadek seryjnego zakażenia HIV-1 skutkującego potrójną infekcją u holenderskiego pacjenta, który pierwotnie był zarażony wirusem podtypu B. 35-letni homoseksualista okazał się serotypem HIV-1 w marcu 2001 roku i został skierowany do obserwacji. Na początku lipca 2003 r. Pacjent miał ostry początek gorączki, katar, kaszel i bóle stawów; objawy trwały około tygodnia. Próbka osocza pobrana podczas epizodu choroby w dniu 24 lipca 2003 r. Wykazała wyjątkowo wysokie obciążenie HIV-1 z wyraźnie zmniejszoną liczbą komórek CD4 + (ryc. 1). Analiza próbek seryjnych pod kątem genotypu wirusa dostarczyła dowodów na nową infekcję HIV-1 przez krążącą rekombinowaną postać 01_AE wirusa (podtypu CRF01_AE), która zdominowała populację wirusa w dniu 24 lipca 2003 r. (Figura 2) i zasugerowała, że pacjent również żył drugi wirus podtypu B. Badanie przechowywanych próbek osocza wykazało, że nadkażenie tym drugim wirusem typu B (wstępnie oznaczonym B2) miało miejsce między lipcem a październikiem 2002 r., Ponieważ próbka uzyskana 22 października 2002 r. Jako pierwsza zawierała sekwencje B2 RNA (ryc. 1) Pacjent nie miał objawów klinicznych ani nie zmniejszył liczby komórek CD4 + po ponownym zakażeniu drugim szczepem podtypu B, podczas gdy ponowna infekcja z bardziej rozbieżnym szczepem podtypu CRF01_AE doprowadziła do ostrej choroby wirusowej, znacznego wzrostu obciążenia wirusem i spadku w liczbie komórek CD4 +. Stwierdzono, że przemijająca nadkażliwość szczepem podtypu B nie powoduje żadnych objawów.4
Nie jest jasne, czy jakikolwiek pacjent z zakażeniem HIV-1 może być nadinfekowany lub czy czynniki gospodarza lub wirusy modulują podatność na nadkażenia. Głównym czynnikiem ryzyka zakażeń seropozytywnych HIV-1 u tego pacjenta był prawdopodobnie jego powtórne narażenie na skutek wielokrotnego niezabezpieczonego kontaktu seksualnego z innymi mężczyznami zakażonymi HIV-1. Ten niecodzienny przypadek ilustruje możliwość wielokrotnego nadkażenia HIV-1 u zakażonego HIV-1 pacjenta, który kontynuuje praktykowanie niebezpiecznego seksu, i podkreśla potrzebę ciągłych działań profilaktycznych mających na celu zapewnienie bezpiecznych praktyk seksualnych nawet wśród osób już zarażonych wirusem HIV. 1.
Antoinette C. van der Kuyl, Ph.D.
Karolina Kozaczynska, mgr inż.
Remco van den Burg, B.Sc.
Fokla Zorgdrager, B.Sc.
Nicole Back, Ph.D.
Suzanne Jurriaans, Ph.D.
Ben Berkhout, Ph.D.
Peter Reiss, MD, Ph.D.
Marion Cornelissen, Ph.D.
Academic Medical Center, 1105 AZ Amsterdam, Holandia
ac [email protected] uva.nl
4 Referencje1. Allen TM, nadkażenie Altfeld M. HIV-1. J Allergy Clin Immunol 2003; 112: 829-835
Crossref Web of Science MedlineGoogle Scholar
2. Gottlieb GS, Nickle DC, Jensen MA, i in. Podwójna infekcja HIV-1 związana z szybkim postępem choroby. Lancet 2004; 363: 619-622 [Erratum, Lancet 2004; 363: 1166].
Crossref Web of Science MedlineGoogle Scholar
3. Cornelissen M, Mulder-Kampinga G, Veenstra J, i in. Tłumienie fenotypów indukujących syncytię (SI) w serokonwersji po domięśniowej inokulacji indukowanej niesyncytinowo / SI fenotypowo mieszanej populacji ludzkiego wirusa upośledzenia odporności. J Virol 1995; 69: 1810-1818
Web of Science MedlineGoogle Scholar
4. Yerly S, Jost S, Monnat M i in. Współistniejące zakażenie HIV-1 u osób zażywających narkotyki dożylnie. AIDS 2004; 18: 1413-1421
Crossref Web of Science MedlineGoogle Scholar
(26)
[przypisy: terapia resynchronizująca serca, zatoka jamista, nacięcie błony bębenkowej ]
[podobne: złamanie spiralne, terapia resynchronizująca, terapia resynchronizująca serca ]