Skip to content

Niezależne genetyczne początki wyraźnych ognisk nowotworów w wieloogniskowym brodawkowatym raku tarczycy czesc 4

1 miesiąc ago

454 words

Dwutiarczyn wodorosiarczynu sodu przekształca niemetylowaną cytozynę w uracyl, ale nie wpływa na metylowaną cytozynę. Ta konwersja powoduje różnicę w sekwencji metylowanych i niemetylowanych alleli. W DNA z guza monoklonalnego amplifikacja PCR z użyciem zestawów primerów specyficznych dla tych różnych nukleotydów umożliwia określenie, który z dwóch alleli HUMARA, które różnią się liczbą jednostek powtarzających CAG, jest metylowany i który allel jest niemetylowany. DNA potraktowano wodorosiarczynem sodu przez noc, oczyszczono za pomocą Czarodziejskiego Systemu Oczyszczania DNA (Promega) i zatężono za pomocą strącania etanolem zgodnie z protokołem Frommer et al.32 Dwie 50-.l mieszaniny reakcyjne PCR zawierające Bufor x PCR, 1,5 mM chlorku magnezu, 200 .M każdego trifosforanu deoksynukleotydu, 40 pmol każdego startera, 2 U polimerazy DNA Amplitaq Gold (Applied Biosystems) i 2 .l DNA traktowanego wodorosiarczynem sodu przeprowadzono dla każdej próbki DNA guza . W pierwszym zastosowano znakowany fluorescencyjnie starter przedni specyficzny dla traktowanej wodorosiarczynem, metylowaną sekwencję DNA HUMARA, a w drugim zastosowano starter przedni specyficzny dla traktowanej wodorosiarczynem, niemetylowanej sekwencji. Startery do PCR były niemetylowanym przednim primerem 5 GGTTGTGAGTGTAGTATTTTTTGGT3 , zmetylowanym przednim primerem 5 CGAGCGTAGTATTTTTCGGC3 i uniwersalnym primerem odwrotnym 5 TAAAAAAAACCATCCTCACC3 .33 Termocykling składał się z denaturacji w 95 ° C przez 10 minut; 30 cykli w 95 ° C przez 30 sekund, 55 ° C przez 30 sekund i 72 ° C przez 30 sekund; i końcowe wydłużanie w 72 ° C przez 10 minut. Próbki poddano elektroforezie w programie ABI Prism 377 Sequencer, a dane analizowano przy użyciu oprogramowania GeneScan i Genotyper (Applied Biosystems).
Wyniki
Przeanalizowano próbki wieloogniskowego brodawkowatego raka tarczycy u 17 kobiet poddanych leczeniu tarczycy w raku brodawkowatym. Preparaty zawierające skrawki zatopione w parafinie z guzów mikroskalowano ręcznie lub za pomocą mikrodyssekcji laserowej, w zależności od wielkości guza oraz ilości zrębu i składników zapalnych, w celu zapewnienia, że próbka zawiera przewagę (typowo ponad 90%). procent za pomocą oględzin) komórek nowotworowych. DNA guza analizowano pod kątem stanu dezaktywacji chromosomu X, stosując traktowanie wodorosiarczynem sodu, następnie PCR specyficzny wobec metylacji, trawienie enzymami restrykcyjnymi specyficznymi względem metylacji, a następnie PCR lub obydwa. Siedem guzów od pięciu pacjentów dawało interpretowalne wyniki w obu procedurach i wykazało zgodność w wynikowych wzorach dezaktywacji chromosomu X.
Rycina 1. Rycina 1. Dyskordowe wzorce inaktywacji X-chromosomu w wyraźnych ogniskach nowotworu od pojedynczego pacjenta z wieloogniskowym rakiem brodawkowatym tarczycy, jak ujawniono przez PCR specyficzny dla metylacji. Na lewym panelu pokazano fotomikrografie (barwione hematoksyliną i eozyną) trzech ognisk nowotworów od Pacjenta 14. Mimo że trzy odrębne raki mają podobny wygląd mikroskopowy, nie mają identycznego wzoru inaktywacji chromosomu X. Dla każdego nowotworu odpowiedni wykres (panele po prawej stronie) jest ilościowym przedstawieniem wielkości i ilości fluorescencyjnych produktów PCR amplifikowanych z DNA nowotworu podczas analizy za pomocą automatycznego sekwencera
[podobne: próba tymolowa, zatoka szyjna, myringotomia ]
[przypisy: amlodypina, cholangiografia, cholecystografia ]