Skip to content

Niezależne genetyczne początki wyraźnych ognisk nowotworów w wieloogniskowym brodawkowatym raku tarczycy cd

1 miesiąc ago

508 words

Te odziedziczone matczynie i ojcowskie chromosomy można odróżnić za pomocą polimorfizmów – w tym przypadku wyraźnej zmiany liczby tandemnie powtarzanych jednostek CAG w obrębie HUMARA. Przy użyciu starterów flankujących powtórzenia CAG, dwa produkty PCR o różnej wielkości można amplifikować z genomowego DNA heterozygotycznego pacjenta. Startery flankujące sekwencję powtórzeń CAG HUMARA flankują również miejsce restrykcyjne HpaII (CCGG), które jest metylowane, a tym samym chronione przed trawieniem, gdy jest obecne na nieaktywnym chromosomie X, ale niemetylowane, a tym samym podatne na cięcie, gdy jest na aktywnym chromosomie X. Dlatego, gdy traktowany HpaII DNA poddaje się PCR z tymi starterami HUMARA, większość kopii nieaktywnego allelu pozostaje nienaruszona i jest amplifikowana, podczas gdy większość kopii aktywnego allelu jest cięta przez HpaII, a zatem niezdolna do otrzymania produktu PCR. Większość kobiet w ogólnej populacji jest heterozygotycznych w miejscu polimorficznym, a zatem podatnych na analizę, a mały rozmiar regionu HUMARA zawierającego polimorfizm i miejsce restrykcyjne umożliwia analizę próbek tkanek utrwalonych i zatopionych w parafinie za pomocą PCR. W DNA z guza monoklonalnego, jeden z alleli HUMARA jest preferencyjnie niemetylowany, a zatem tracony, a przerzuty nowotworowe z tego nowotworu mają taki sam wzór inaktywacji chromosomu X jak pierwotny nowotwór. Jeżeli jednak powstanie wiele ognisk guzów niezależnie, matczyny chromosom X będzie inaktywowany w niektórych ogniskach, a ojcowski X będzie inaktywowany w innych.
Połowę DNA z każdej próbki strawiono w 20 .l mieszaniny reakcyjnej z 12 U HpaII (New England Biolabs) w 37 ° C przez 12 do 16 godzin. Druga połowa została poddana pozorowanemu trawieniu bez enzymu. Po inkubacji enzym restrykcyjny inaktywowano w 95 ° C przez 10 minut.
50 .l mieszaniny reakcyjnej PCR zawierało 1x bufor do PCR (15 mM chlorowodorek TRIS, pH 8,0 i 50 mM chlorek potasu), 1,5 mM chlorek magnezu, 200 .M każdego trifosforanu deoksynukleotydu, 40 pmol każdego startera, 2 U Amplitaq Złota polimeraza DNA (Applied Biosystems) i 5,0 ul strawionego lub trawionego DNA. Jako startery zastosowano 5 TCCTATGACACCATTTGGG3 z fluorescencyjnym znacznikiem TET na końcu 5 i 5 CTCTACGATGGGCTTGGGAGAAC3 . Termocykling polegał na denaturacji w 95 ° C przez 10 minut; 30 cykli w 95 ° C przez 30 sekund, 55 ° C przez 30 sekund i 72 ° C przez 30 sekund; i końcowe wydłużanie w 72 ° C przez 10 minut. Próbki poddano elektroforezie w programie ABI Prism 377 Sequencer, a dane analizowano przy użyciu oprogramowania GeneScan i Genotyper (Applied Biosystems).
Aby uwzględnić różnice w obciążeniu żelu i skuteczności amplifikacji PCR, obliczono stosunek wysokości pików alleli w guzie i normalnych próbek za pomocą następującego wzoru: (szczyt wysokość niestrawionej próbki ÷ szczyt 2 wysokość niestrawionej próbki) ÷ (szczyt wysokość strawionej próbki ÷ szczyt 2 wysokość strawionej próbki). Stosunek większy niż 2,0 lub mniejszy niż 0,5, reprezentujący preferencyjną utratę intensywności w strawionej próbce 50 procent jednego z dwóch alleli obecnych w normalnej próbce, oceniono jako wzór monoklonalny i zanotowano niemetylowany allel.
Bisiarczyn sodu i PCR specyficzny dla metylacji
Test PCR specyficzny dla metylacji był również stosowany do badania klonalności w locus HUMARA
[hasła pokrewne: rzepka dwudzielna, cholecystografia, torbiel zastoinowa ]
[więcej w: złamanie podstawy czaszki, zatoka jamista, zatoka szyjna ]